Journal: bioRxiv

Article Title: Cell binding, uptake and infection of influenza A virus using recombinant antibody-based receptors

doi: 10.1101/2024.07.29.605726

Figure Lengend Snippet: (A) Representative fluorescent microscopy images of fixed cells stained with fluorescein-labeled SNA or MAL I. Relative fluorescence level of (B) SNA- and (C) MAL I, stained live cells quantified by flow cytometry. MFI intensities were normalized relative to HEK WT Sia expression (B, C). Background (unstained) subtracted MFI values were analyzed using PRISM software; MFI = Mean fluorescent intensity. *, Error bars show mean ± standard mean error. Statistics were calculated using ANOVA. P<0.05; ****P<0.0001; n=6. (D) Unmodified (WT), and Slc35A1 KO A549 cells transduced with an Slc35A1 encoding lentivirus (LV- Slc35A1 ) were fixed and stained with biotinylated SNA or MAL II (magenta) and DAPI (blue). The Alexa Fluor 647-Streptavidin signal intensities were assessed via microscopy. Images are representative of n=3 independent replicates. Scale bar represents 50µm. (E, F) Cells from (D) were incubated with biotinylated SNA or MAL II and the APC-streptavidin in live cells analyzed via flow cytometry. Following subtraction of the median APC signal of corresponding background samples, the median APC signal was normalized to that of WT cells. Data are means +/- standard error of mean/standard deviation from n=3 independent experiments. Statistical significance was inferred by two-tailed one sample t test with a theoretical mean of 100. ***P<0.001, **P< 0.01.

Article Snippet: Protein concentration was determined by Qubit (Invitrogen) and stored at -80°C in aliquots. pMslc expressing the human Slc35A1 gene was a gift from Dr. Christopher Buck (Addgene plasmid #32095).

Techniques: Microscopy, Staining, Labeling, Fluorescence, Flow Cytometry, Expressing, Software, Transduction, Incubation, Standard Deviation, Two Tailed Test

Journal: bioRxiv

Article Title: Cell binding, uptake and infection of influenza A virus using recombinant antibody-based receptors

doi: 10.1101/2024.07.29.605726

Figure Lengend Snippet: (A) Representative fluorescent microscopic images of fixed cells incubated with HA-hFc probe and detected with fluorescein-labelled anti-human Fc. (B) Relative fluorescent intensities of live HA-hFc-stained cells quantified by flow cytometry. Fluorescent intensities were normalized relative to fTfR-5J8 expressing cells. (C) The fTfR and fTfR-5J8 expression was analyzed in A549 Slc35A1 KO cells transduced with lentiviruses encoding fTfR (LV-fTfR) or fTfR-5J8 (LV-fTfR-5J8) via qPCR. Primers targeting GAPDH, the extracellular domain of fTfR and 5J8 were utilized. Data are 40-Ct values from technical triplicates from n=1 experiment. A Ct of 40 was assigned to samples where no amplification was detected. (D) Cells from (C) and A549 Slc35A1 KO cells stably expressing SLC35A1 (LV- Slc35A1 ) were inoculated with A/Netherlands/602/09 at a MOI 25 for 1.5hr on ice. Cells were incubated with an anti-HA antibody and the signal from bound virus quantified via flow cytometry. A representative histogram from n=3 independent experiments is shown. (E) Quantification of the percentage of IAV positive cells from (D). The gating strategy was established using the mock-infected sample. Data are means ± standard deviation and statistical significance was inferred by one-way ANOVA with Sidak’s multiple comparisons test. ****P<0.0001.

Article Snippet: Protein concentration was determined by Qubit (Invitrogen) and stored at -80°C in aliquots. pMslc expressing the human Slc35A1 gene was a gift from Dr. Christopher Buck (Addgene plasmid #32095).

Techniques: Incubation, Staining, Flow Cytometry, Expressing, Transduction, Amplification, Stable Transfection, Virus, Infection, Standard Deviation

Journal: bioRxiv

Article Title: Cell binding, uptake and infection of influenza A virus using recombinant antibody-based receptors

doi: 10.1101/2024.07.29.605726

Figure Lengend Snippet: (A) Representative fluorescence microscopy images of fixed Ca’09 infected cells. Receptors (fTfR-5J8 and full-length fTfR) were transiently expressed on HEK Slc35A1 KO for 24hrs before viral infection (MOI = 0.2) for 8hrs. Cells were fixed and stained with anti-NP antibody (green) and DAPI (blue). (B and C) Infection data for Ca’09 or PR8 infected cells respectively. Four different fields of view were imaged for each condition and % infection was determined. Data was normalized to HEK WT infected cells. (D) Infection curve for the Neth/09 -Renilla at MOI = 3 in A549 LV-fTfR, LV-fTfR-5J8 and LV- Slc35A1 cells. (E) AUC plot from D, where AUC values of LV-fTfR-5J8 and LV-fTfR are shown relative to LV- Slc35A1. ND = No infection detected, NS = not significant, AUC = Area under the curve, MOI = Multiplicity of infection. All experiments were performed in three independent replicates (n=3). Error bars show mean ± standard mean error. Statistics were calculated using ANOVA. *P<0.05; **P<0.01, ****P<0.0001.

Article Snippet: Protein concentration was determined by Qubit (Invitrogen) and stored at -80°C in aliquots. pMslc expressing the human Slc35A1 gene was a gift from Dr. Christopher Buck (Addgene plasmid #32095).

Techniques: Fluorescence, Microscopy, Infection, Staining

Journal: bioRxiv

Article Title: Cell binding, uptake and infection of influenza A virus using recombinant antibody-based receptors

doi: 10.1101/2024.07.29.605726

Figure Lengend Snippet: A549 Slc35A1 KO cells stably expressing SLC35A1 (LV- Slc35A1 ) or fTfR-5J8(LV-5J8-TfR) were pre-treated with Dynasore (40-20µM), Pitstop 2 (15-10µM), NH 4 Cl (25mM) or DMSO (0.15%) for 30 minutes at 37°C and then infected with Neth/09- Renilla at a MOI 3 in their presence. (A) Cell viability at 24 hours post-inhibitor treatment relative to the DMSO control. (B) Neth/09 -Renilla infection curves. Dashed line indicates luminescence from the mock-infected sample. (C) AUC values from (B) were normalized to the DMSO-treated sample within each cell line. (A-C) Data are means ± standard deviation from n=3 independent experiments. Statistical significance in (C) was determined by two-tailed one sample t-test with a theoretical mean of 100. *P<0.05, ns = not significant.

Article Snippet: Protein concentration was determined by Qubit (Invitrogen) and stored at -80°C in aliquots. pMslc expressing the human Slc35A1 gene was a gift from Dr. Christopher Buck (Addgene plasmid #32095).

Techniques: Stable Transfection, Expressing, Infection, Control, Standard Deviation, Two Tailed Test

Journal: Molecular Therapy. Methods & Clinical Development

Article Title: Comparing the efficacy of γ- and electron-irradiation of PBMCs to promote secretion of paracrine, regenerative factors

doi: 10.1016/j.omtm.2021.02.016

Figure Lengend Snippet: Cytokine secretion of γ- and electron-irradiated PBMCs (A) Immunodetection array membrane with annotations of the most abundant analytes detected in the secretomes of PBMCs. Each spot represents one analyte, and each analyte is spotted in duplicates. (B) Cytokine secretion profiles of 60 Gy γ- and 60 Gy electron-irradiated PBMCs. Pooled secretomes of n = 4 donors per condition were analyzed. (C) Analysis of integrated densities of chemiluminescent signals. Each column represents one analyte. Colors indicate fold changes of integrated intensities. (D) Pooled secretomes of n = 4 donors were measured by ELISA in technical triplicates. Bar diagrams show mean and standard deviation. For statistical analysis, two-tailed Mann-Whitney was performed. BAFF, B cell activating factor; BDNF, brain-derived neurotrophic factor; CFD, complement factor D; DPPIV, dipeptidyl-peptidase IV; EGF, epidermal growth factor; ENA-78, epithelial-derived neutrophil-activating protein 78; FGF19, fibroblast growth factor 19; ICAM1, intercellular adhesion molecule 1; IL1ra, interleukin 1 receptor antagonist; IL6, interleukin 6; IL8, interleukin 8; IL10, interleukin 10; IL11, interleukin 11; IL16, interleukin 16; IL17A, interleukin 17A; IL18BPa, interleukin 18-binding protein isoform a; IL22, interleukin 22; IL24, interleukin 24; MCP1, monocyte chemotactic protein 1; MIF, macrophage migration inhibitory factor; MIP3α, macrophage inflammatory protein 3 alpha; MMP9, matrix metallopeptidase 9; PDGF-AA, platelet-derived growth factor subunit A; PDGF-AB/BB, platelet-derived growth factor subunits A and B; PF4, platelet factor 4; RANTES, regulated and normal T cell expressed and secreted; RBP, retinol-binding protein; SDF1α, stromal cell-derived factor 1 alpha; PAI-1, plasminogen activator inhibitor-1; TFF3, trefoil factor 3; TIM3, T cell immunoglobulin and mucin-domain containing-3; uPAR, urokinase-type plasminogen activator receptor; VEGF, vascular endothelial growth factor; vitamin D BP, vitamin D-binding protein; TGFβ1, transforming growth factor beta 1.

Article Snippet: Cytokines were assessed by the Proteome Profiler Assay Human XL Cytokine Array Kit (R&D Systems, Minneapolis, MN, USA), according to the manufacturer’s instructions.

Techniques: Irradiation, Immunodetection, Membrane, Enzyme-linked Immunosorbent Assay, Standard Deviation, Two Tailed Test, MANN-WHITNEY, Derivative Assay, Binding Assay, Migration

Journal: Human Mutation

Article Title: Weaver Syndrome‐Associated EZH2 Protein Variants Show Impaired Histone Methyltransferase Function In Vitro

doi: 10.1002/humu.22946

Figure Lengend Snippet: Weaver syndrome mutants are impaired in their histone methyltransferase activity in vitro . Histone methyltransferase reactions were performed using 2 μg purified core histones and 0.67 μM 3 H‐S‐adenosyl‐methionine ( 3 H‐SAM). Each reaction was incubated with 250 ng of either wild‐type (WT) or a mutant HMTase complex (or no enzyme controls). Histone methyltransferase activity was measured based on the incorporation of 3 H‐labeled methyl groups, represented in scintillation counts per minute. Counts were normalized by subtracting background counts (i.e., no enzyme) from the total counts. A : Incorporation of tritiated methyl groups from 3 H‐SAM onto core histones is shown for each complex: EZH2 WT • , p.(Phe672Ile) × , p.(Pro132Ser) ★ , p.(Tyr153del) △, p.(His694Tyr) ▽, p.(Glu745Lys) ▴, p.(Ala682Thr) ▾, p.(Arg684Cys) ▪, p.(Tyr133Cys) □, and p.(Asp185His) ◇. Error bars represent standard deviation (SD) within the groups “EZH2 WT” and “EZH2 mutants.” Unpaired t‐test showed statistically significant difference between the two groups (P value < 0.0001). B : Incorporation of tritiated methyl groups from 3 H‐SAM onto core histones is shown for the positive control EZH2 WT, the negative control EZH2 (p.Phe672Ile), and the mutant complex with activity closest to WT, namely, EZH2 (p.Pro132Ser). Error bars represent SD of four independent replicates for the controls, and three independent replicates for the mutant EZH2 (p.Pro132Ser). One‐way ANOVA showed statistically significant difference between all groups (overall P value < 0.0001; P values between WT and p.(Phe672Ile), between p.(Phe672Ile) and p.(Pro132Ser), and between WT and p.(Pro132Ser) were all <0.05).

Article Snippet: To test our hypothesis, we designed recombinant human EZH2 proteins, had them preassembled into PRC2 complexes (BPS Bioscience, San Diego CA), and tested their activity in vitro using a well‐accepted in vitro assay [Ernst et al., ; Yap et al., ; Score et al., ].

Techniques: Activity Assay, In Vitro, Purification, Incubation, Mutagenesis, Labeling, Standard Deviation, Positive Control, Negative Control

Journal: Cancer Immunology Research

Article Title: Granulocyte–Macrophage Colony-Stimulating Factor Influence on Soluble and Membrane-Bound ICOS in Combination with Immune Checkpoint Blockade

doi: 10.1158/2326-6066.CIR-22-0702

Figure Lengend Snippet: Comparison between human ICOS full length and splice variant. A, Schematic representation of full length and spliced variant of human ICOS. The full length of ICOS consists of 5 exons. The gray boxes denote untranslated regions, and the black boxes denote coding sequences. The transmembrane domain (TM) is located in exon 3 and labeled with a green bar. The splicing region is shown in red. B, Comparison of cDNA nucleotide sequences, amino acid sequences, and 5′UTR sequences between ICOS-FL and the splice variant. Nucleotide sequences of cDNA for ICOS-FL (b1) and the splice variant of ICOS (b4) are represented; spliced region of ICOS is shown in red and delineated by red brackets; the nucleotides and amino acids of TM are shown in green. Asterisk indicates the stop codon. Amino acid sequences of full length of ICOS (b2) and the splice variant of ICOS (b5) are shown. The underline depicts additional differences in amino acid sequence compared with ICOS-FL. “Stop” represents a stop codon. 5′UTR sequences of ICOS-FL (b3) and the splice variant of ICOS (b6) are shown. The 5′UTR of the ICOS-SV lacks 32 nucleotides compared with the 5′UTR of ICOS-FL shown in red and delineated by red brackets. C, Schematic diagram of ICOS-FL and the ICOS-SV protein. Thirty-two out of 38 amino acids in the intracellular domain are spliced, as shown in red.

Article Snippet: To evaluate soluble ICOS-SVs in the sera of melanoma patients or cell culture supernatants, the Human ICOS DuoSet ELISA kit (DY169, R&D Systems) was used according to the manufacturer's protocol.

Techniques: Comparison, Variant Assay, Labeling, Sequencing

Journal: Cancer Immunology Research

Article Title: Granulocyte–Macrophage Colony-Stimulating Factor Influence on Soluble and Membrane-Bound ICOS in Combination with Immune Checkpoint Blockade

doi: 10.1158/2326-6066.CIR-22-0702

Figure Lengend Snippet: Secretion of the ICOS-SV from ICOS-SV–overexpressing cells. A, RT-PCR to detect the ICOS-SV in human T cells. Total RNA was isolated from purified T cells in PBMCs of a healthy donor. Expression of the ICOS variant was examined by RT-PCR with specific primers. RT-PCR of ICOS-FL is shown as a control. B, DNA sequencing of ICOS-SV cDNA from human T cells. The cDNA of the PCR product was cloned into a TOPO TA vector. The ICOS-SV was confirmed by DNA sequencing using an M13 forward primer. Splicing point is shown by the red arrow. C, DNA sequencing of ICOS-FL cDNA is shown as a control. No splicing occurs in the region corresponding to the position in ( B ), as shown in blue. D, Expression of ICOS-SV and ICOS-FL in 293T cells determined by immunoblot. 293T cells were transduced with recombinant GFP retroviral vector encoding either ICOS-SV or ICOS-FL as a positive control. The parental cells and the GFP-empty vector–transduced cells were used as negative controls. Sample loading was normalized to actin. E, Cell culture supernatants were collected from the cells described in ( A ). Secreted ICOS-SV was examined by ELISA. Two-tailed unpaired t test was used to compare ICOS secretion between the two groups. ***, P < 0.001. Standard deviation of the mean (SD) is shown. F, To validate the secreted ICOS variant protein in the cell supernatant, immunoprecipitation, SDS-PAGE, and immunoblotting assays were performed. Sample loading was normalized to cell numbers.

Article Snippet: To evaluate soluble ICOS-SVs in the sera of melanoma patients or cell culture supernatants, the Human ICOS DuoSet ELISA kit (DY169, R&D Systems) was used according to the manufacturer's protocol.

Techniques: Reverse Transcription Polymerase Chain Reaction, Isolation, Purification, Expressing, Variant Assay, Control, DNA Sequencing, Clone Assay, Plasmid Preparation, Western Blot, Transduction, Recombinant, Retroviral, Positive Control, Cell Culture, Enzyme-linked Immunosorbent Assay, Two Tailed Test, Standard Deviation, Immunoprecipitation, SDS Page

Journal: Cancer Immunology Research

Article Title: Granulocyte–Macrophage Colony-Stimulating Factor Influence on Soluble and Membrane-Bound ICOS in Combination with Immune Checkpoint Blockade

doi: 10.1158/2326-6066.CIR-22-0702

Figure Lengend Snippet: Suppressive effects of sICOS-SV on the costimulation of T cells. A, CHO-K1 cells were transduced with either ICOSL-expressing lentiviral vector or GFP-empty vector (CHO-ICOSL − ) as a negative control. Expression of ICOSL on the cell surface of CHO-K1 was examined by flow cytometry using anti-ICOSL (open histogram with solid line) or lentivirus GFP-empty vector (open histogram with dotted line). Isotype antibody was used as a negative control (filled histogram). B, ICOSL-expressing CHO-K1 cells were stained with ICOS-SV Ig (red line), control IgG Ig (blue line), or PD-1 Ig (orange line) and analyzed by flow cytometry. Both soluble control Ig and PD-1 Ig were used as negative controls. GFP-empty vector-expression CHO-K1 cells stained with ICOS-SV Ig (green line) were used as another negative control for the binding assay. Isotype antibody control was used as a negative control (gray filled histogram). C, CD154 expression was determined by FACS analysis. Isotype control antibody is shown in gray. Activated T cells treated with a suboptimal dose of anti-CD3 were incubated with control Ig + CHO-ICOSL − cells (CHO cells transduced with GFP-empty vector, blue), control Ig + CHO-ICOSL + cells (green), PD-1 Ig + CHO-ICOSL + cells (red), or ICOS-SV Ig + CHO-ICOSL + cells (yellow). Both control Ig and PD-1 Ig were used as negative controls. D, Two-tailed unpaired t test was used to compare expression of CD154 between two groups. **, P < 0.01; ***, P < 0.001. Standard deviation of the mean (SD) is shown. E, CD69 expression was determined by FACS analysis. Isotype control antibody is shown in gray. Activated T cells treated with a suboptimal dose of anti-CD3 were incubated with control Ig + CHO-ICOSL − cells (CHO cells transduced with GFP-empty vector, blue), control Ig + CHO-ICOSL + cells (green), PD-1 Ig + CHO-ICOSL + cells (red), or ICOS-SV Ig + CHO-ICOSL + cells (yellow). Both control Ig and PD-1 Ig were used as negative controls. F, Two-tailed unpaired t test was used to compare expression of CD69 between the two groups. **, P < 0.01; ***, P < 0.001. Standard deviation of the mean (SD) is shown. G, CHO cells transduced with GFP-empty vector (CHO-ICOSL − ) were used as negative controls. Sample loading was normalized to total pan-Akt. H, T-cell proliferation was determined by a [ 3 H]-TdR thymidine incorporation assay. CHO cells transduced with empty vector (CHO-ICOSL − ) were used as negative controls. Two-tailed unpaired t test was used to compare 3 H uptake between the two groups, respectively. *, P < 0.1. Standard deviation of the mean (SD) is shown. I, Schematic diagram of ICOS/ICOSL costimulatory T-cell proliferation, as well as the blocking function of the sICOS-SV. Depicted are the cytoplasmic tail sequences of ICOS-FL and sICOS-SV isoforms. The YMFM Src Homology 2 (SH2) binding motif in the cytoplasmic tail of the ICOS-FL is highlighted in pink. Upon ICOS engagement by the ICOSL on CHO cells, the unique YMFM motif recruits a p85a and a p50a subunits of PI3K, resulting in the elevated phosphorylation of Akt, thereby inducing PI3K activity. In contrast, the ICOS-SV, a truncated isoform lacking the YMFM motif in its cytoplasmic tail, cannot elicit phosphorylation of Akt. Consequently, it fails to promote T-cell proliferation. The secreted ICOS-SV (red) competes with membrane-bound ICOS for binding to ICOSL, thereby blocking the interaction between ICOSL and membrane ICOS. As a result, the sICOS-SV suppresses phosphorylation of Akt and T-cell proliferation, leading to the inhibition of T-cell immunity. The diagram was created with BioRender.com. All data shown are representative of at least 2 independent experiments.

Article Snippet: To evaluate soluble ICOS-SVs in the sera of melanoma patients or cell culture supernatants, the Human ICOS DuoSet ELISA kit (DY169, R&D Systems) was used according to the manufacturer's protocol.

Techniques: Transduction, Expressing, Plasmid Preparation, Negative Control, Flow Cytometry, Staining, Control, Binding Assay, Incubation, Two Tailed Test, Standard Deviation, Thymidine Incorporation Assay, Blocking Assay, Phospho-proteomics, Activity Assay, Membrane, Inhibition

Journal: Cancer Immunology Research

Article Title: Granulocyte–Macrophage Colony-Stimulating Factor Influence on Soluble and Membrane-Bound ICOS in Combination with Immune Checkpoint Blockade

doi: 10.1158/2326-6066.CIR-22-0702

Figure Lengend Snippet: sICOS from melanoma patients inhibits T-cell activation and proliferation induced by GM-CSF–driven DCs in MLRs. A, CD4 + T cells (responders) were stimulated by allogeneic GM-CSF–driven MoDCs (stimulators: negative control DCs, DCs generated by GM-CSF/IL4 + anti-IgG, or DCs generated by GM-CSF/IL4 + anti-CD116) in MLRs. T cells were assessed for activation via flow cytometry using anti-ICOS (blue), anti-GITR (green), or anti-CD25 (gray). Isotype control antibodies were used as negative controls. B, Statistical analysis of the percentage of CD4 + ICOS + , CD4 + GITR + , and CD4 + CD25 + T-cell populations from different groups as described above. C, Soluble ICOS levels were determined by ELISA using supernatants from the MLRs described above. D – E, Serum from sICOS-high and sICOS-negative patients were added to the MLRs, and T-cell proliferation ( D ) and CD69 expression ( E ) were evaluated. Additionally, sICOS was depleted from sICOS-high serum to assess its effects on T cells. F, Statistical analysis of the percentage of CD4 + CD69 + T-cell populations from different groups as described above. All data shown are representative of at least 2 independent experiments. Two-tailed unpaired t test was used between the two groups. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; ns, not significant ( P > 0.05). Standard deviation of the mean (SD) is shown.

Article Snippet: To evaluate soluble ICOS-SVs in the sera of melanoma patients or cell culture supernatants, the Human ICOS DuoSet ELISA kit (DY169, R&D Systems) was used according to the manufacturer's protocol.

Techniques: Activation Assay, Negative Control, Generated, Flow Cytometry, Control, Enzyme-linked Immunosorbent Assay, Expressing, Two Tailed Test, Standard Deviation

Journal: Scientific Reports

Article Title: Dipeptidyl Peptidase-4 and Adolescent Idiopathic Scoliosis: Expression in Osteoblasts

doi: 10.1038/s41598-017-03310-x

Figure Lengend Snippet: Impact of long-term treatment with GLP-1 on DPP-4 expression. Cells were treated with GLP-1 (10 mM) for 24 hours. ( a ) DPP4 gene expression was measured in osteoblasts of controls (n = 3) and AIS patients (n = 6) by RT-qPCR with GAPDH as endogenous control. Relative expression was analyzed with the 2 −ΔΔCT method. ( b ) DPP-4 protein expression in osteoblasts of controls and AIS patients (n = 3/group) was measured by Western blot with β-actin as endogenous control. **P < 0.01 vs. untreated controls; ### P < 0.001 vs. treated controls using one-way ANOVA followed by Tukey’s post-hoc tests. Data are presented as mean ± standard deviation.

Article Snippet: Following cDNA synthesis, qPCR was performed using Taqman gene expression probes for human (DPP4 # Hs00175210_m1; GAPDH #Hs02758991_G1 ) and mouse ( Dpp4 # Mm00494549_m1 ; Gapdh # Mm99999915_g1 ) according to the manufacturer’s instructions.

Techniques: Expressing, Gene Expression, Quantitative RT-PCR, Control, Western Blot, Standard Deviation

Journal: Scientific Reports

Article Title: Dipeptidyl Peptidase-4 and Adolescent Idiopathic Scoliosis: Expression in Osteoblasts

doi: 10.1038/s41598-017-03310-x

Figure Lengend Snippet: Impact of short-term treatments with glucose and insulin on DPP-4 expression. Cells were treated with glucose (5 mM), insulin (0.3 nM) and glucose + insulin (5 mM and 0.3 nM) for 2 hours. ( a ) DPP4 gene expression in osteoblasts of controls (n = 3) and AIS patients (n = 4–6) was measured by RT-qPCR with GAPDH as endogenous control. Relative expression was analyzed with the 2 −ΔΔCT method. ( b ) DPP-4 protein expression in osteoblasts of controls and AIS patients (n = 3/group) was measured by Western blot with β-actin as endogenous control. *P < 0.05 and **P < 0.01 vs. untreated controls; # P < 0.05 and ## P < 0.01 vs. treated controls using one-way ANOVA followed by Tukey’s post-hoc tests. Data are presented as mean ± standard deviation.

Article Snippet: Following cDNA synthesis, qPCR was performed using Taqman gene expression probes for human (DPP4 # Hs00175210_m1; GAPDH #Hs02758991_G1 ) and mouse ( Dpp4 # Mm00494549_m1 ; Gapdh # Mm99999915_g1 ) according to the manufacturer’s instructions.

Techniques: Expressing, Gene Expression, Quantitative RT-PCR, Control, Western Blot, Standard Deviation

Journal: Scientific Reports

Article Title: Dipeptidyl Peptidase-4 and Adolescent Idiopathic Scoliosis: Expression in Osteoblasts

doi: 10.1038/s41598-017-03310-x

Figure Lengend Snippet: Impact of long-term treatments with glucose and insulin on DPP-4 expression. Cells were treated with glucose (5 mM), insulin (0.3 nM) and glucose + insulin (5 mM and 0.3 nM) for 24 hours. ( a ) DPP4 gene expression in osteoblasts of controls (n = 3) and AIS patients (n = 4–6) was measured by RT-qPCR with GAPDH as endogenous control. Relative expression was analyzed with the 2 −ΔΔCT method. ( b ) DPP-4 protein expression in osteoblasts of controls and AIS patients (n = 3/group) was measured by Western blot with β-actin as endogenous control. *P < 0.05 and **P < 0.01 vs. untreated controls; ## P < 0.01 and ### P < 0.001 vs. treated controls using one-way ANOVA followed by Tukey’s post-hoc tests. Data are presented as mean ± standard deviation.

Article Snippet: Following cDNA synthesis, qPCR was performed using Taqman gene expression probes for human (DPP4 # Hs00175210_m1; GAPDH #Hs02758991_G1 ) and mouse ( Dpp4 # Mm00494549_m1 ; Gapdh # Mm99999915_g1 ) according to the manufacturer’s instructions.

Techniques: Expressing, Gene Expression, Quantitative RT-PCR, Control, Western Blot, Standard Deviation

Journal: Scientific Reports

Article Title: Dipeptidyl Peptidase-4 and Adolescent Idiopathic Scoliosis: Expression in Osteoblasts

doi: 10.1038/s41598-017-03310-x

Figure Lengend Snippet: STAT1 gene and protein expression in osteoblasts isolated from control and AIS patients. ( a ) STAT1 gene expression was measured in osteoblasts of controls (n = 7) and AIS patients (n = 13) by RT-qPCR with GAPDH as endogenous control. Relative expression was analyzed with the 2 −ΔΔCT method. ( b ) STAT-1 protein expression was evaluated by Western blot (n = 3/group) and β-actin was used as endogenous control. *P < 0.05 using two-tailed Student’s t-test. Data are presented as mean ± standard deviation.

Article Snippet: Following cDNA synthesis, qPCR was performed using Taqman gene expression probes for human (DPP4 # Hs00175210_m1; GAPDH #Hs02758991_G1 ) and mouse ( Dpp4 # Mm00494549_m1 ; Gapdh # Mm99999915_g1 ) according to the manufacturer’s instructions.

Techniques: Expressing, Isolation, Control, Gene Expression, Quantitative RT-PCR, Western Blot, Two Tailed Test, Standard Deviation

Journal: Nature Communications

Article Title: ASPSCR1-TFE3 reprograms transcription by organizing enhancer loops around hexameric VCP/p97

doi: 10.1038/s41467-024-45280-5

Figure Lengend Snippet: a Plot of enrichment scores (defined in Methods) for homologous proteins identified on mass spectroscopy proteomics following ASPSCR1 immunoprecipitation (IP) of nuclear lysates from human FU-UR-1 cells ( n = 8 + 2 controls IgG) and mouse ASPS tumors ( n = 7 + 3 controls IgG) b IPs followed by western blots (WB) showing reciprocal AT3 (by ASPSCR1 or TFE3 antibodies) and VCP interactions in multiple tumor cell circumstances, but not control HCT116 cells (input = 10% of sample; FT = flow-through; IP-IgG and FT-IgG lanes are mock IPs with non-specific IgG; each IP-WB was repeated on a biologically independent sample; all uncropped gel images provided in Source Data file in ). c IP-WBs demonstrating reciprocal interactions in multiple tumor contexts between AT3 and MATR3 or MTA2 ( n = 2 biological repeat not shown). d ASPSCR1, TFE3, and AT3 constructs oriented left-to-right:amino-to-carboxy. Gray background coded by ASPSCR1 ; slashes indicate amino acids 1-311. White background coded by TFE3 ; slashes indicate exon 4 through 3’-terminus; black coded by exon 3, the putative activation domain. e FLAG-IP-WB for MATR3, MTA2, and VCP in HEK cells transfected with FLAG-tagged constructs. Expression varied on n = 3 biological repeats: more AT3.2 was expressed in the iteration of the experiment depicted. f Fluorescence photomicrographs of a human ASPS tumor and control clear cell sarcoma (CCS) and Ewing sarcoma (ES) tumors stained with DAPI, TFE3 (detecting AT3), and VCP antibodies. (panel = 100 µm square; n > 4 fields per each of n = 4 tumors/controls). g Fluorescence images of HEK293T co-transfected with VCP-GFP and either ASPSCR1-TFE3-mRFP or mRFP alone. (panel = 30 µm square). Nuclear (nuc.) and cytoplasmic (cyt.) fraction western blots (WBs) for VCP ( n > 4 fields per n = 2 biological repeated experiment). h Fluorescence photomicrographs of proximity ligation assay (PLA) between TFE3 and VCP antibodies in the ASPS tumor and controls, with an additional IgG-PLA control. (panel=100 µm square; n > 4 fields per each of n = 4 tumors/controls). i Quantitative fluorescent PLA signal per nucleus was measured in (79, 57, 143, 29, 105, 81, 83, 57, 216, 271, 215, 244, 84, 59, 195, 65 nuclei for the samples listed in order.).

Article Snippet: HEK293T cells were obtained from ATCC and were maintained in DMEM supplemented with 10% FBS.

Techniques: Mass Spectrometry, Immunoprecipitation, Western Blot, Control, Construct, Activation Assay, Transfection, Expressing, Fluorescence, Staining, Proximity Ligation Assay

Journal: Nature Communications

Article Title: ASPSCR1-TFE3 reprograms transcription by organizing enhancer loops around hexameric VCP/p97

doi: 10.1038/s41467-024-45280-5

Figure Lengend Snippet: a WB for VCP after BN-PAGE of whole cell lysates from HEK293T cells after transfection with control GFP, ASPSCR1, AT3, truncated ASPSCR1 (trASPSCR1, the portion included in AT3) or truncated TFE3 (trTFE3, the portion included in AT3). VCP hexamer size is ~582 kD ( n = 3 biological repeats performed with similar result). b Mass spectrometry results after FLAG-IP from HEK293T cells transfected with tagged ASPSCR1 or AT3, showing VCP predominant in both, other than the peptides aligned with the FLAG-tagged bait itself, noted in red as ASPSCR1 or both ASPSCR1 and TFE3. c Negative stain TEM micrographs of FLAG-IP eluates after ASPSCR1 or AT3 overexpression in HEK293T cells (bars = 20 nm; biological repeats n = 3). d Reference-free 2D class averages of negatively stained particles recovered from FLAG-AT3 co-IP reveal intact VCP hexameric assemblies. Left and middle, VCP top or pore views (3620 and 2774 particles in each class, respectively); right, VCP side view (182 particles; box length and width = 25 nm). e Schematic of constructs of each type of AT3 as well as CΔ, a truncated portion of the carboxy half of ASPSCR1, not included in AT3 (HA human influenza hemagglutinin tag; NLS nuclear localization signal). Orientation from top-to-bottom is amino-to-carboxy termini. f VCP WB after BN-PAGE following transfection of HEK293T cells with ASPSCR1, CΔ, or an empty vector control as well as the last of these transfections treated subsequently with VCP inhibitor CB-5083 (biological repeats n = 3). g VCP WB after BN-PAGE following IP for TFE3-FLAG or AT3-FLAG with or without co-transfected CΔ, along with denaturing gel blots of input proteins below (biological repeats n = 3). h Negative stain TEM micrographs of in vitro mixing of VCP with control green fluorescent protein (GFP) or CΔ, with AT3, added in the order of the molar ratios listed (bars = 20 nm; biological repeats n = 2).

Article Snippet: HEK293T cells were obtained from ATCC and were maintained in DMEM supplemented with 10% FBS.

Techniques: Transfection, Control, Mass Spectrometry, Staining, Over Expression, Co-Immunoprecipitation Assay, Construct, Plasmid Preparation, In Vitro

Journal: Nature Communications

Article Title: ASPSCR1-TFE3 reprograms transcription by organizing enhancer loops around hexameric VCP/p97

doi: 10.1038/s41467-024-45280-5

Figure Lengend Snippet: a Heatmaps of overlapping enrichment in ChIP-seq with antibodies against AT3 and VCP in human FU-UR-1 cells, ASPS-1 cells, two human ASPS tumors, and 3 mouse ASPS tumors. Each heatmap is centered on peaks across the genome, sorted by AT3 enrichment, representing at least 2 replicates. b Example tracks with overlaid ChIP-seq enrichments of AT3 and VCP at selected highly enriched target genes (See also Supplementary Fig. ). Tracks scaled together 0 to 15 reads per million (RPM). c Graph depicting mean ± standard deviation as well as raw value points of fold-enrichment of double cross-linked VCP ChIP over input chromatin by quantitative polymerase chain reaction (qPCR) for two AT3-expressing cell lines (ASPS-1 and FU-UR-1) and two control cell lines (HCT116, colon cancer; ASKA, synovial sarcoma) at a panel of selected target genes and one negative control locus ( CCND2 ). Two-tailed Student’s t -test generated p -values as indicated. d Similar graph of VCP ChIP enrichment over input for FU-UR-1 cells exposed for 48 h to control siSCR or one of two siTFE3s directed against AT3. e Similar graph of VCP ChIP enrichment over input for HEK293T cells transfected with GFP control, TFE3 control, ASPSCR1 control, AT3.1 or AT3.2.

Article Snippet: HEK293T cells were obtained from ATCC and were maintained in DMEM supplemented with 10% FBS.

Techniques: ChIP-sequencing, Standard Deviation, Real-time Polymerase Chain Reaction, Expressing, Control, Negative Control, Two Tailed Test, Generated, Transfection

Journal: Nature Communications

Article Title: ASPSCR1-TFE3 reprograms transcription by organizing enhancer loops around hexameric VCP/p97

doi: 10.1038/s41467-024-45280-5

Figure Lengend Snippet: a Correlation of fold-change (FC; to control) FU-UR-1 RNA-seq transcription comparing siRNAs that deplete VCP or AT3 among target genes (highly enriched AT3 region genes with >2FC by AT3 depletion. ( n = 3 × 2 siRNAs each for VCP and AT3, pooled.) b Similar targets correlation for ASPS-1 (also n = 3 × 2 pooling). c RT-qPCR for target genes (controls HPRT , VCP ) for HEK293T expressing TFE3, type 1 or 2 ASPSCR1::TFE3 (AT3.1, AT3.2), each with or without exogenous VCP (VCP ex ) overexpression. ( n = 3, pooled; mean ± standard deviation; homoscedastic two-tailed t -tests comparing added VCP ex to each alone.) d Genes plotted had at least 8-fold upregulated expression by RNA-seq for TFE3, AT3.1, and AT3.2 relative to control GFP in the absence of CΔ in HEK293T cells. The plot indicates log transformed p -values and FC comparing each transcription factor with co-transfected CΔ to that without CΔ. Co-transfected CΔ to HEK293T cells changes TFE3 targets in both directions, mostly insignificantly. CΔ significantly downregulates most AT3.1/AT3.2 targets ( n = 3 each group, homoscedastic two-tailed t -tests). e Less pronounced correlation between the differential expression by RNA-seq in ASPS-1 from CB-5083 relative to vehicle at 48 h ( n = 3 for each) to siRNAs depleting VCP relative to control at 48 h ( n = 3 × 2 pooled for each). f The same for FU-UR-1 cells (for CB-5083 experiment, n = 2 for each). g Plot of log-transformed p -values and FCs of CB-5083 or DMSO treated HEK293T cells transfected with TFE3. The genes included were 8-fold upregulated by TFE3, AT3.1 and AT3.2 over GFP control transfection. Most significant changes showed further upregulation by CB-5083. ( n = 3, pooled, homoscedastic two-tailed t -tests). h Genes upregulated by CB-5083 added to TFE3 are mostly downregulated by CB-5083 added to AT3.1 or AT3.2. ( n = 3, pooled, homoscedastic two-tailed t -tests). i Schematic working model where VCP hexamers interact with chromatin via AT3 to activate transcription, abrogated by VCP depletion, hexamer disassembly, or enzymatic inhibition, the last with mixed impacts. j RT-qPCR for target genes after TFE3, AT3.1, or AT3.2 expression in HEK293T with co-transfection of control, VCP, or VCP E305Q (hexamer-assembling, enzymatically inactive mutant), which increases some targets’ expression ( n = 3, pooled; mean ± st.dev.; homoscedastic two-tailed t -tests).

Article Snippet: HEK293T cells were obtained from ATCC and were maintained in DMEM supplemented with 10% FBS.

Techniques: Control, RNA Sequencing, Quantitative RT-PCR, Expressing, Over Expression, Standard Deviation, Two Tailed Test, Transformation Assay, Transfection, Quantitative Proteomics, Inhibition, Cotransfection, Mutagenesis

Journal: PLoS ONE

Article Title: The cellular prion protein interacts with and promotes the activity of Na,K-ATPases

doi: 10.1371/journal.pone.0258682

Figure Lengend Snippet: (A) Design of gRNA targeting PRNP coding sequence. (B) CRISPR-Cas9-based knockout of PrP in ReN VM cells. (C) Validation of PrP knockout in ReN VM cells. Note that PrP deficiency has no effect on steady-state ATP1A1 levels in this model. (D) PrP knockout diminishes 86 Rb + uptake in ReN VM cells. Depicted are normalized mean plus standard deviation. (E) Increased steady-state ATP1A1 levels in RML-infected Neuro2a cells. (F) Similar to PrP knockout, RML-infection of Neuro2a cells compromises 86 Rb + uptake, albeit to a lesser extent. Statistical analyses in subpanels of this figure were based on the two-tailed t-test applied to three biological replicates.

Article Snippet: Briefly, the selected gRNA human PrP ( CACTGGGGGCAGCCGATACCCGG ) was cloned into the gRNA plasmid (catalog number MLM3636, Addgene, MA, USA) following digestion with the BsmBI enzyme (catalog number R0580S, New England BioLabs, MA, USA) and verified by Sanger sequencing.

Techniques: Sequencing, CRISPR, Knock-Out, Biomarker Discovery, Standard Deviation, Infection, Two Tailed Test

Journal: Molecular Therapy Oncolytics

Article Title: Generation of a Tumor-Specific Chemokine Gradient Using Oncolytic Vesicular Stomatitis Virus Encoding CXCL9

doi: 10.1016/j.omto.2019.12.003

Figure Lengend Snippet: LM2 Cells Transduced with Lenti-mCXCL9 Have Reduced Tumorigenicity In Vivo Compared with LM2 (A) Concentration of mCXCL9 levels in the supernatants of LM2 cells transduced with Lenti-mCXCL9. ELISA data are shown at 24 h after plating in triplicate + standard deviation (****p < 0.0001). (B) Viability of LM2-Lenti-mCXCL9 compared with LM2 cells in vitro . Data are shown as mean percent cell viability in comparison with mock-infected cells at 24, 48, and 72 h postinfection + standard deviation. (C) Survival of mice bearing LM2 or Lenti-transduced LM2 tumors was evaluated using Kaplan-Meier survival curves (*p < 0.05).

Article Snippet: Mouse cxcl9 was PCR amplified from a mCXCL9 cloning plasmid (catalog number MG50155-M; Sino Biological, Wayne, PA, USA).

Techniques: Transduction, In Vivo, Concentration Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation, In Vitro, Infection

Journal: Molecular Therapy Oncolytics

Article Title: Generation of a Tumor-Specific Chemokine Gradient Using Oncolytic Vesicular Stomatitis Virus Encoding CXCL9

doi: 10.1016/j.omto.2019.12.003

Figure Lengend Snippet: Murine and Human CXCL9 Transgenes Engineered in Recombinant VSVs Do Not Alter the Growth Kinetics or Viral Killing Ability In Vitro Schematic depiction of the genomes of recombinant VSVs encoding murine (A) or human (B) CXCL9, CXCLi, and GFP. (C) Replication kinetics of VSVs encoding murine or human CXCL9 were performed in a multistep viral growth curve in Vero cells. Data are shown from duplicate experiments as average titer + standard deviation. (D) Viability of VSV-mCXCL9-, VSV-mCXCLi-, and VSV-GFP-infected Vero and murine LM2 tumor cells was assessed at 24 and 48 h postinfection at an MOI of 10. (E) Viability of VSV-M51R-hCXCL9- and VSV-M51R-hCXCLi-infected Vero and human FaDu-Luc tumor cells was measured at 24 and 72 h postinfection at an MOI of 10. Data are presented as duplicate experiments as average percent viability compared with mock-infected cells + standard deviation. Significance was determined by paired t test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

Article Snippet: Mouse cxcl9 was PCR amplified from a mCXCL9 cloning plasmid (catalog number MG50155-M; Sino Biological, Wayne, PA, USA).

Techniques: Recombinant, In Vitro, Standard Deviation, Infection

Journal: Molecular Therapy Oncolytics

Article Title: Generation of a Tumor-Specific Chemokine Gradient Using Oncolytic Vesicular Stomatitis Virus Encoding CXCL9

doi: 10.1016/j.omto.2019.12.003

Figure Lengend Snippet: CXCL9 Expressed from VSV-mCXCL9 Is Biologically Active (A) Murine CXCL9 secretion was evaluated in vitro in the LM2 non-small cell lung cancer cell line. Supernatants of VSV-infected LM2 cells (MOI 0.1) were collected 24 h postinfection, and chemokine concentration was determined by ELISA. Concentrations are presented as average concentration + standard deviation. (B) Chemotactic activity of virally encoded mCXCL9 was assessed in an in vitro migration assay adapted from Campanella et al. Numbers of migrated cells are presented as average percent increase in migration compared with mock treated + standard deviation. Significance was determined by paired two-tailed t test (**p < 0.01).

Article Snippet: Mouse cxcl9 was PCR amplified from a mCXCL9 cloning plasmid (catalog number MG50155-M; Sino Biological, Wayne, PA, USA).

Techniques: In Vitro, Infection, Concentration Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation, Activity Assay, Migration, Two Tailed Test

Journal: Molecular Therapy Oncolytics

Article Title: Generation of a Tumor-Specific Chemokine Gradient Using Oncolytic Vesicular Stomatitis Virus Encoding CXCL9

doi: 10.1016/j.omto.2019.12.003

Figure Lengend Snippet: Oncolytic Activity of VSV-mCXCL9 Survival of mice bearing 5TGM1 or LM2 tumors was evaluated using Kaplan-Meier survival curves. (A) 5 × 10 6 5TGM1 cells were implanted subcutaneously on the right flanks of C57Bl6/KaLwRij mice; once tumors had grown to ∼6-mm diameter, mice were injected intravenously with PBS, VSV-mCXCL9, or VSV-GFP (n = 10 for PBS and VSV-mCXCL9 treatments, n = 9 for VSV-GFP treatment). (B) 1 × 10 6 LM2 cells were implanted subcutaneously on the right flanks of A/J mice, and established tumors (∼6-mm diameter) were injected intratumorally with PBS, VSV-mCXCL9, or VSV-GFP (n = 10 for all treatment groups). Survival analysis was performed using log rank statistics (***p < 0.001, ****p < 0.0001).

Article Snippet: Mouse cxcl9 was PCR amplified from a mCXCL9 cloning plasmid (catalog number MG50155-M; Sino Biological, Wayne, PA, USA).

Techniques: Activity Assay, Injection

Journal: Molecular Therapy Oncolytics

Article Title: Generation of a Tumor-Specific Chemokine Gradient Using Oncolytic Vesicular Stomatitis Virus Encoding CXCL9

doi: 10.1016/j.omto.2019.12.003

Figure Lengend Snippet: Generation of a Tumor to Blood CXCL9 Chemokine Gradient after Intratumoral VSV-mCXCL9 Administration Intratumoral and serum mCXCL9 protein concentrations were determined after intratumoral injection of VSV-mCXCL9 or VSV-GFP in LM2 tumor-bearing mice by ELISA (n = 3 mice/group for each time point). Values are presented as average chemokine concentration in pg/mL + standard deviation. Significance was determined by paired two-tailed t test (**p < 0.01).

Article Snippet: Mouse cxcl9 was PCR amplified from a mCXCL9 cloning plasmid (catalog number MG50155-M; Sino Biological, Wayne, PA, USA).

Techniques: Injection, Enzyme-linked Immunosorbent Assay, Concentration Assay, Standard Deviation, Two Tailed Test

Journal: Molecular Therapy Oncolytics

Article Title: Generation of a Tumor-Specific Chemokine Gradient Using Oncolytic Vesicular Stomatitis Virus Encoding CXCL9

doi: 10.1016/j.omto.2019.12.003

Figure Lengend Snippet: VSV-mCXCL9 Does Not Increase CD8 + or Th1 Cell Intratumoral Infiltration or CD8 + Inflammatory Cytokine Production LM2 tumors were harvested and processed 7 and 10 days after intratumoral (i.t.) injection of VSV-mCXCL9, VSV-GFP, or PBS, and flow data were gated on (A) CD45 + CD3 + CD8 + T cells or (C) CD45 + CD3 + CD4 + T-bet + (Th1) cells. T cell numbers are presented as average number of immune cells/mg tumor ± standard deviation (n = 4 mice/group/day). (B) Cytokine production was gated on TNF-α- and IFN-γ-producing cells from (A). Statistical significance was determined by paired two-tailed t test (*p < 0.05).

Article Snippet: Mouse cxcl9 was PCR amplified from a mCXCL9 cloning plasmid (catalog number MG50155-M; Sino Biological, Wayne, PA, USA).

Techniques: Injection, Standard Deviation, Two Tailed Test

Journal: PLoS ONE

Article Title: GLP2-2G-XTEN: A Pharmaceutical Protein with Improved Serum Half-Life and Efficacy in a Rat Crohn’s Disease Model

doi: 10.1371/journal.pone.0050630

Figure Lengend Snippet: A) ESI-MS analysis, major peak 83,142 Da – full length intact GLP2-2G-XTEN; minor peak 83,003 Da – des-His GLP2-2G-XTEN. B) non-reducing SDS-PAGE. Lane 1: molecular weight markers, lanes 2–4: 2 µg, 5 µg and 10 µg of GLP2-2G-XTEN, respectively. C) Size exclusion HPLC analysis. Solid curve: GLP2-2G-XTEN, 20 µg; dashed curve: molecular weights standard, which includes thyroglobulin 670 kDa, IgG 156 kDa, BSA 66 kDa, ovalbumin 45 kDa, myoglobin 17 kDa. D) Potency GPCR assay of GLP2-2G EC50 = 7 nM (95% confidence interval 4 nM to 12 nM) and GLP2-2G-XTEN EC50 = 380 nM (95% confidence interval 330 nM to 430 nM).

Article Snippet: In the assay, standards, controls and test samples were incubated with mouse anti-XTEN monoclonal antibody (ProSci, 4D9G3) which was immobilized on a microtiter plate at a concentration of 8 μg/mL.

Techniques: SDS Page, Molecular Weight

Journal: PLoS ONE

Article Title: GLP2-2G-XTEN: A Pharmaceutical Protein with Improved Serum Half-Life and Efficacy in a Rat Crohn’s Disease Model

doi: 10.1371/journal.pone.0050630

Figure Lengend Snippet: Pharmacokinetic data for GLP2-2G-XTEN in mouse, rat and cynomolgus monkey.

Article Snippet: In the assay, standards, controls and test samples were incubated with mouse anti-XTEN monoclonal antibody (ProSci, 4D9G3) which was immobilized on a microtiter plate at a concentration of 8 μg/mL.

Techniques:

Journal: PLoS ONE

Article Title: GLP2-2G-XTEN: A Pharmaceutical Protein with Improved Serum Half-Life and Efficacy in a Rat Crohn’s Disease Model

doi: 10.1371/journal.pone.0050630

Figure Lengend Snippet: GLP2-2G-XTEN plasma concentration is shown following 25 nmol/kg administration via intravenous (triangle) or subcutaneous (square) route. Three animals were dosed by each route of administration. Data points are the average ± s.d. of three animals per time point.

Article Snippet: In the assay, standards, controls and test samples were incubated with mouse anti-XTEN monoclonal antibody (ProSci, 4D9G3) which was immobilized on a microtiter plate at a concentration of 8 μg/mL.

Techniques: Clinical Proteomics, Concentration Assay

Journal: PLoS ONE

Article Title: GLP2-2G-XTEN: A Pharmaceutical Protein with Improved Serum Half-Life and Efficacy in a Rat Crohn’s Disease Model

doi: 10.1371/journal.pone.0050630

Figure Lengend Snippet: Small intestine weight A) and length B) in normal rats following treatment with a total dose of 300 nmol/kg GLP2-2G peptide or GLP2-2G-XTEN. Data shown are from day 12 following SC injection of GLP2-2G peptide (12.5 nmol/kg per injection; twice per day for 12 days) and GLP2-2G-XTEN (25 nmol/kg per injection; once per day for 12 days). Data are means and SE, n = 10 per group. * P<0.05 compared to vehicle-treated rats, # P<0.05 compared to GLP2-2G peptide treated rats.

Article Snippet: In the assay, standards, controls and test samples were incubated with mouse anti-XTEN monoclonal antibody (ProSci, 4D9G3) which was immobilized on a microtiter plate at a concentration of 8 μg/mL.

Techniques: Injection

Journal: PLoS ONE

Article Title: GLP2-2G-XTEN: A Pharmaceutical Protein with Improved Serum Half-Life and Efficacy in a Rat Crohn’s Disease Model

doi: 10.1371/journal.pone.0050630

Figure Lengend Snippet: Data shown are A) change in body weight from day −3 through day 2, B) small intestine length, C) small intestine adhesion score, D) small intestine trans-ulceration score and E) small intestine TNFα concentration. Open bars are healthy rats treated with vehicle; colored bars are indomethacin-induced diseased rats treated with vehicle, GLP2-2G peptide (12.5 nmol/kg per injection; twice per day for 5 days) or GLP2-2G-XTEN (25 nmol/kg once per day for 5 days) as indicated. Compounds were dosed starting three days prior to first indomethacin injection (Day −3) and data shown are from the time of sacrifice on Day 2 (24 hours post second indomethacin injection). Data are means and SE, n = 10 per group. * P<0.05 compared to diseased, vehicle-treated rats, # P<0.05 compared to diseased GLP2-2G peptide treated rats.

Article Snippet: In the assay, standards, controls and test samples were incubated with mouse anti-XTEN monoclonal antibody (ProSci, 4D9G3) which was immobilized on a microtiter plate at a concentration of 8 μg/mL.

Techniques: Concentration Assay, Injection

Journal: PLoS ONE

Article Title: GLP2-2G-XTEN: A Pharmaceutical Protein with Improved Serum Half-Life and Efficacy in a Rat Crohn’s Disease Model

doi: 10.1371/journal.pone.0050630

Figure Lengend Snippet: Data shown are effects on A) small intestine adhesions and B) small intestine trans-ulcerations. Treatment with GLP2-2G peptide (12.5 nmol/kg per injection; twice per day for 5 days) or GLP2-2G-XTEN (25 nmol/kg once daily or only once at the indicated doses) was initiated on Day −3 and sacrifice is on Day 2. Data are means and SE, n = 10 per group. * P<0.05 compared to diseased, vehicle-treated rats.

Article Snippet: In the assay, standards, controls and test samples were incubated with mouse anti-XTEN monoclonal antibody (ProSci, 4D9G3) which was immobilized on a microtiter plate at a concentration of 8 μg/mL.

Techniques: Injection

Journal: PLoS ONE

Article Title: GLP2-2G-XTEN: A Pharmaceutical Protein with Improved Serum Half-Life and Efficacy in a Rat Crohn’s Disease Model

doi: 10.1371/journal.pone.0050630

Figure Lengend Snippet: A) Hematoxylin and eosin staining of jejunum sections from A) diseased, vehicle-treated rats, B) diseased, GLP2-2G-XTEN high dose treated rats (125 nmol/kg total dose divided into five daily 25 nmol/kg doses), C) diseased, GLP2-2G-XTEN low dose treated rats (75 nmol/kg total dose given once on day −3) and D) diseased, GLP2-2G-XTEN low dose treated rats (divided into three 25 nmol/kg doses on day −3, −1 and 1).

Article Snippet: In the assay, standards, controls and test samples were incubated with mouse anti-XTEN monoclonal antibody (ProSci, 4D9G3) which was immobilized on a microtiter plate at a concentration of 8 μg/mL.

Techniques: Staining

Journal: PLoS ONE

Article Title: GLP2-2G-XTEN: A Pharmaceutical Protein with Improved Serum Half-Life and Efficacy in a Rat Crohn’s Disease Model

doi: 10.1371/journal.pone.0050630

Figure Lengend Snippet: A) Small intestine length B) villi height and C) mucosal atrophy, ulceration, infiltration measurements from diseased, vehicle-treated, GLP2-2G peptide-treated, and GLP2-2G-XTEN-treated rats. Quantitative histopathology was not performed on GLP2-2G-XTEN 75 nmol/kg single dose group.

Article Snippet: In the assay, standards, controls and test samples were incubated with mouse anti-XTEN monoclonal antibody (ProSci, 4D9G3) which was immobilized on a microtiter plate at a concentration of 8 μg/mL.

Techniques: Histopathology

Journal: Haematologica

Article Title: Hepatocyte growth factor promotes migration of human myeloma cells.

doi: 10.3324/haematol.11867

Figure Lengend Snippet: Figure 1. INA-6 cells (A) or primary MM cells (B) were seeded in the upper compartment of a two-chamber Transwell migration assay. To the bottom compartment was added RPMI-medium with or without FGF2 (10 ng/mL), HGF (150 ng/mL), IGF-1 (100 ng/mL), IL-15 (20 ng/mL), SDF-1α (75 ng/mL), TNF (20 ng/mL) or VEGF (100 ng/mL). After 22 hrs. at 37°C, cells in the bottom compartments were counted and percentage of migrated cells calculated. Error bars represent +1 standard deviation (SD) of three repeated counts in two independent measurements. A is representative for three similar experiments. B represents 1 out of 5 primary cell samples. Migration increased significantly when cells were subjected to specific cytokines, according to an unpaired Student’s two-tailed test, *(p<0.01).

Article Snippet: Recombinant human FGF2, IGF-1, interleukin (IL)-15 and VEGF were from R&D Systems Inc. (Minneapolis, MN, USA), IL-6 was from Biosource (Camarillo, CA, USA) and SDF-1α from Peprotech (London, UK).

Techniques: Transwell Migration Assay, Standard Deviation, Migration, Two Tailed Test

Journal: Emerging Microbes & Infections

Article Title: Establishment of replication-competent vesicular stomatitis virus-based recombinant viruses suitable for SARS-CoV-2 entry and neutralization assays

doi: 10.1080/22221751.2020.1830715

Figure Lengend Snippet: Characterization of rVSV-eGFP-SARS-CoV-2. (A) Schematic diagrams showing genome organization in rVSV vectors. The original VSV G gene was replaced by SARS-CoV-2 S gene to generate rVSV-eGFP-SARS-CoV-2. eGFP was inserted into the first position of the genome. (B) Lysate of rVSV-eGFP-SARS-CoV-2 producing cells (Lane 1) and purified rVSV-eGFP-SARS-CoV-2 (Lane 2) were analysed by western blot using an antibody recognizing the RBD domain of the S protein. (C) Images of mock- (upper panels) or rVSV-eGFP-SARS-CoV-2-infected (lower panels) Vero cells stained with Hoechst to label the nuclei (blue). The GFP signal is shown in green. The overlay of blue and green is shown to visualize syncytia. (D) The titers of neutralizing antibodies (NAbs) in three serum samples from COVID-19 convalescent patients were determined against rVSV-eGFP-SARS-CoV-2 by a focus reduction neutralization test. rVSV-eGFP-EBOV (Ebola virus) were used as a control virus. (E) Growth kinetics of rVSV-eGFP-SARS-CoV-2 in Vero cells (MOI=0.0l). Viral titers were measured by a focus-forming assay and expressed as focus forming units per ml (FFU/ml). Error bars in (D-E) indicate standard deviation of the mean (n=3). (F) Plaque morphology of rVSVs in Vero cells. The plaques of rVSV-eGFP-EBOV (upper panel) or rVSV-eGFP-SARS-CoV-2 (middle panel) at 72 h post-infection indicated by yellow arrowhead were visualized under microscope. Lower panel: Mock-infected cells (control). The data represent three independent experiments.

Article Snippet: Rabbit anti-SARS-CoV-2 S-RBD polyclonal antibody (Cat. 40150-RP01) and SARS-CoV-2 Spike RBD domain (Cat: 40592-V08B-B) were purchased from Sino Biological Inc. (Beijing, China).

Techniques: Purification, Western Blot, Infection, Staining, Neutralization, Focus Forming Assay, Standard Deviation, Microscopy

Journal: Emerging Microbes & Infections

Article Title: Establishment of replication-competent vesicular stomatitis virus-based recombinant viruses suitable for SARS-CoV-2 entry and neutralization assays

doi: 10.1080/22221751.2020.1830715

Figure Lengend Snippet: Characteristics of rVSV-eGFP-SARS-CoV-2 entry. (A) Infectivity of rVSV-eGFP-SARS-CoV-2 and rVSV-eGFP-G on various cell types. Infectivity was quantified by counting GFP positive cells in the above nine cell lines. The infectious titers were expressed as log 10 FFU/ml. The limit of detection was 10 FFU/ml. Titers below 10 FFU/ml (★) are indicated. (B) Inhibition of rVSV-eGFP-SARS-CoV-2 infection by NH 4 Cl. Vero cells were infected with rVSV-eGFP-SARS-CoV-2 or rVSV-eGFP-EBOV at MOI of 0.01 after treatment with different concentrations of NH 4 Cl. The results are expressed as the percentage of the control (without NH 4 Cl treatment). (C) Effect of SARS-CoV-2 RBD fragment on the infectivity of rVSV-eGFP-SARS-CoV-2. All infection experiments were performed in triplicate. Error bars in (A–C) indicate standard deviation of the mean (n=3).

Article Snippet: Rabbit anti-SARS-CoV-2 S-RBD polyclonal antibody (Cat. 40150-RP01) and SARS-CoV-2 Spike RBD domain (Cat: 40592-V08B-B) were purchased from Sino Biological Inc. (Beijing, China).

Techniques: Infection, Inhibition, Standard Deviation

Journal: Emerging Microbes & Infections

Article Title: Establishment of replication-competent vesicular stomatitis virus-based recombinant viruses suitable for SARS-CoV-2 entry and neutralization assays

doi: 10.1080/22221751.2020.1830715

Figure Lengend Snippet: Comparison of rVSV-eGFP-SARS-CoV-2-based neutralization assay with pseudotype and live viruses. (A) IC 50 values for 8 human mAbs against rVSV-eGFP-SARS-CoV-2 and VSV pseudotype. NAb titers of the mAbs against rVSV-eGFP-SARS-CoV-2 was evaluated by a focus reduction neutralization test. NAb titers against pseudovirus was evaluated by pseudovirus based neutralization assay (PBNA). IC 50 was calculated by the Reed-Muench method. (B) Correlation of IC 50 values in (A) between pseudovirus- and rVSV-based assays. (C) IC 50 values for six serum samples from COVID-19 convalescent patients against rVSV-eGFP-SARS-CoV-2 and SARS-CoV-2. NAb titers of the serum samples against SARS-CoV-2 was determined by plaque reduction neutralization test, and IC 50 was calculated by the Reed-Muench method. (D) Correlation of IC 50 values in COVID-19 patients measured by rVSV-eGFP-SARS-CoV-2 and SARS-CoV-2.

Article Snippet: Rabbit anti-SARS-CoV-2 S-RBD polyclonal antibody (Cat. 40150-RP01) and SARS-CoV-2 Spike RBD domain (Cat: 40592-V08B-B) were purchased from Sino Biological Inc. (Beijing, China).

Techniques: Neutralization, Endpoint Dilution Assay, Plaque Reduction Neutralization Test

Journal: Emerging Microbes & Infections

Article Title: Establishment of replication-competent vesicular stomatitis virus-based recombinant viruses suitable for SARS-CoV-2 entry and neutralization assays

doi: 10.1080/22221751.2020.1830715

Figure Lengend Snippet: Validation of rVSV-eGFP-SARS-CoV-2-based neutralization assay. (A) Representative inhibition curves of two positive and two negative human serum samples. (B) The limit of detection (LOD) of the assay. A subset of negative serum samples from 20 mice and 4 humans was tested against rVSV-eGFP-SARS-CoV-2 using the focus reduction neutralization test. (C) Reproducibility of the neutralization assay. Pooled positive serum samples (n=2) were run six times per experiment in total of three experiments to measure reproducibility. Individual IC 50 values were plotted to evaluate the intra- and inter-assay variability. Error bars in (A–C) indicate standard deviation of the mean.

Article Snippet: Rabbit anti-SARS-CoV-2 S-RBD polyclonal antibody (Cat. 40150-RP01) and SARS-CoV-2 Spike RBD domain (Cat: 40592-V08B-B) were purchased from Sino Biological Inc. (Beijing, China).

Techniques: Neutralization, Inhibition, Inter Assay, Standard Deviation